Aim: of 60µg/ml and 30µg/ml, respectively with

Aim: The present study
was carried out to compare the sensitivity of biofilm detection methods, and to
study the effect of ursolic acid as a potential anti biofilm agent in
dispersing the slime generated by Staphylococcal sp isolated from milk
samples of crossbred dairy cows. Further, in the Staphylococcal isolates, the
presence of intracellular adherence gene locus involved in biofilm production (icaD)
was investigated and compared with the other pathogenic gene loci mecA
and pvl.

Materials and Methods:
A total of 50 S. aureus strains were isolated
over a period of 3 months from 281 milk samples collected from crossbred dairy
cows on the date of drying. These isolates were subjected for biofilm detection
by Congo Red Agar (CRA), Microtitre Plate Assay (MTP) and Polymerase Chain
Reaction specific for icaD gene.
The antagonistic effect of biofilm formation by ursolic acid was studied by
using different concentrations (30µg/ml and 60µg/ml) of ursolic acid and
compared with the control group. Molecular detection by PCR of icaD, mecA
and pvl genes
involved in biofilm production, methicillin résistance and production of
leukocidin toxin, respectively in the isolated Staphylococcus sp was also undertaken.

Your time is important. Let us write you an essay from scratch
100% plagiarism free
Sources and citations are provided


Get essay help

Results: Current study
showed that PCR (100%) was highly sensitive, compared to MTP (90%) and CRA
(34%) methods. The in vitro studies on
effect of ursolic acid in inhibiting biofilm formation by Staphylococcus
aureus using MTP assay showed
71.5% and 48.6% inhibition at ursolic acid concentrations of 60µg/ml and
30µg/ml, respectively with a significant
difference (P<0.01) between the treated and untreated isolates. The scanning electron microscopy also further revealed inhibition of biofilm formation when isolates were treated with ursolic acid. Molecular detection of icaD, mecA and pvl gene for biofilm production, methicillin résistance and leukocidin toxin, respectively of Staphylococcus isolates showed that  50 isolates were positive for icaD, 15 isolates positive for mecA, while all the isolates tested were negative for pvl gene. Conclusion: PCR was quicker, and had highest sensitivity among the three assays tested in detection of Staphylococcal biofilms which can effectively be disassociated by ursolic acid treatment. Thirty percent of the isolates studied were also methicillin resistant where as no relationship was found to exist in the current study between biofilm formation and leukocidin toxin production ability of the Staphylococcal isolates. This must be considered as an alarming situation and so attention must be paid towards implementation of new ways for effective prophylaxis, control and development of therapeutic regimes with combination of antibiotic and effective antibiofilm agent for treatment of infections in dairy farms.   INTRODUCTION Biofilm, an extracellular polymeric substance, also referred to as slime, is a polymeric conglomeration generally composed of extracellular DNA, proteins, and polysaccharides (Hall-Stoodley et al., 2004, Lear and Lewis, 2012). The ability of Staphylococcus species to produce biofilm is a most important reason in the failure of eradication of infection and recurrent infections of mammary gland (Melchior et al., 2006). Production of slime enables adhesion of bacteria to the epithelium of mammary glands and thus facilitates persistence in the host tissue and protection from host defence mechanisms. Production of biofilm depends on the presence of the gene cluster icaADBC (the intracellular adhesion locus) and strains harbouring the icaADBC cluster are known to be potential biofilm producers (Cramton et al., 1999). Intracellular adhesin is encoded in the ica locus containing icaA, icaB, icaC, icaD genes in S. aureus strains (Cramton et al 1999  and  McKenney et al  1998). Further, icaD plays an important role in expression of this enzyme. icaA and icaD were found to be in high prevalance among S. aureus mastitis isolates and this finding confirms that ica locus has a potential role as a virulence factor in the pathogenesis of mastitis in ruminants (Vasudevan et al 2003). Dispersal of cells from the biofilm colony is an essential stage of the biofilm life cycle. It enables biofilms to spread and colonize on new surfaces (Kaplan 2004, Xavier et al 2005). Enzymes that degrade the biofilm extracellular matrix, such as dispersin B and Deoxyribonuclease, play a significant role in biofilm dispersal. Biofilm matrix degrading enzymes may be useful as anti-biofilm agents. Ursolic acid (3-beta-3-hydroxy-urs-12-ene-28-oic-acid; UA) is a lipophilic pentacyclic triterpenoid; it was found to be present in the epicuticular waxes of apples in 1920. It is widely found naturally in the peels of fruits, as well as in many herbs and spices such as lavender, oregano, thyme, rosemary, and thyme (Wo?niak et al., 2015). Ursolic acid from the tree Diospyros dendo added at the rate of 10µg/ml decreased biofilm formation in E.coli V.harveyi and P.aeuroginosa PAO1. Transcriptome analysis showed induction of chemotaxis and motility genes in E.coli  treated with the plant derived compound, suggesting that ursolic acid may function as a signal that tells cells to remain motile hindering cell adhesion or destabilizing already formed biofilms (Ren et al. 2005). Detection of methicillin resistance is influenced by several factors as mec regulatory genes, ?lactamase regulatory genes and fem genes. Detection of mecA gene is the most reliable and fundamental method of identifying methicillin-resistant Staphylococcus aureus (Allaouchiche et al 1999). Most of the clinical isolates show hetereogenous resistance in routine culture conditions and therefore detection of the presence of mecA gene by PCR is accepted as gold standard (Chambers 1998). PVL may be found in both methicillin-susceptible Staphylococcus aureus (MSSA) and methicillin-resistant Staphylococcus aureus (MRSA) strains (PREVOST et al., 1995). Hence the present study was carried out to study the biofilm detection methods and the effect of ursolic acid as a potential antibiofilm agent in dispersing the slime of Staphylococcal sp isolated from milk samples of crossbred dairy cows on the date of drying. Further the presence of intracellular adherence gene locus involved in biofilm production (icaD) was investigated and compared with the other pathogenic gene loci viz. mecA and pvl. MATERIALS AND METHODS: Bacterial isolates and phenotypic identification Ninety three S.aureus strains were isolated over a period of 3 months from 281 milk samples of crossbred dairy cows. Milk samples were centrifuged at 2000 g at 370C for 10 minutes, supernatant was discarded, and 5 ml of BHI broth was added to the sediment and incubated at 370C for 24 h (Cruickshank et al., 1975). After incubation of milk samples in BHI broth, the morphology of the organisms was studied with Gram's stain and cultural characters of the isolates was studied using Mannitol Salt Agar (MSA). For discrimination of S.aureus from coagulase negative staphylococci, the coagulase test was performed. The isolates were also subjected to various biochemical tests as per the methods described by Cruickshank et al. (1975) and Bailey and Scott's (2007). Biofilm Detection Methods Slime production was evaluated by cultivation of Staphylococcus isolates on Congo Red Agar (CRA) plates (Mathur et al., 2006). Isolates were interpreted according to their colony phenotypes described by Vasudevan et al (2003). Quantification of Biofilm formation by Microtitre Plate Assay (MTP) was performed according to Dubravka et al. (2014) and Stepanovic et al (2003). The optical density (OD) of each well was measured using a micro plate ELISA reader BioTek (USA) at 630 nm. Cut-off OD (ODc) is defined as three standard deviations above the mean OD of the negative control. Strains were interpreted as follows: Non biofilm producers (OD ? ODc); Weak biofilm producers (ODc < OD ? 2 × ODc); Moderate biofilm producers (2 × ODc < OD ? 4 × ODc); Strong biofilm producers (4 × ODc < OD). Inhibitory Rates (%) For Biofilm Formation Upon Ursolic Acid Treatment The antagonist effect of biofilm formation by ursolic acid was studied by using different concentrations (30µg/ml and 60µg/ml) of ursolic acid and its comparison with the control group that did not receive any treatment. Inhibitory effect was studied by CRA and MTP methods. Anti biofilm effect was detected by dividing the Staphylococcal isolates into three groups, control isolates (group1), ursolic acid treated isolates at a concentration of 30µg/ml (group2) and ursolic acid treated isolates at the rate of 60µg/ml (group3).   The inhibitory rates were calculated using the formula         Inhibitory rate (%) = OD (Control) - OD (Sample) / OD (Control) × 100%. Scanning Electron Microscopy (SEM) Scanning Electron Microscopic (SEM) studies were conducted for 3 types of samples (a) Non Biofilm Staphylococcus, b) Biofilm forming Staphylococcus, (c) Staphylococcus grown in the presence of the ursolic acid 30µg/ml. The samples were scanned under Scanning Electron Microscope (SEM- Model: JOEL-JSM5600) at required magnifications as per the standard procedures at RUSKA Labs, College of Veterinary Science, PVNRTVU, Rajendranagar, Hyderabad, India. Molecular characterization: DNA extraction Genomic DNA isolation for the 50 Staphylococcal isolates was carried out by Phenol Chloroform DNA extraction method. The extracted DNA were dissolved in 30?l sterile distilled water and stored in ?20°C. PCR detection of icaD, mecA and pvl genes The extracted DNA was used for PCR for the detection of methicillin resistance gene (mecA), biofilm formation gene (icaD) and leukocyte cytotoxicity gene (pvl) of Staphylococcus sp. Primers used in PCR to amplify icaD, mecA and pvl was supplied by IDTTM Bangalore as described by Vasudevan et al. (2003), Petinaki et al. (2001) and Steegee et al (2012) with the expected amplicon sizes of approximately 381bp, 1050bp, 91bp, respectively. The primers used in the study their nucleotide sequence and annealing temperatures are icaDF:5'AAACGTAAGAGAGGTGG 3', R: 5' GGCAATATGATCAAGATAC 3', mecA F: 5' GGTCCCATTAACTCTGAAG 3', R: 5' AGTTCTGCAGTACCGGATTTGC 3' and pvl F:     5'GCTGGACAAAACTTCTTGGAATAT3'R:5'GATAGGACACCAATAAATTCTGGATTG3'. The reaction mixture was set up with 25 µl reaction consisting of template 2.5µl, Taq buffer(10X)2.5 µl, dNTPs (10 mM) 0.5 µl, Forward primer (10uM) 2.5 µl, Reverse primer 10 (Um) 2.5µl, Taq polymerase 1.0 µl, nuclease free water 13.5µl. 35 amplification cycles were carried out with specific annealing temperatures of 49oC, 54 oC, and 59 oC, respectively for icaD, mec A, and pvl genes respectively. Statistical Analysis Data was analyzed using SPSS software version 15 evaluation for windows. One way ANOVA was carried for comparing the effect of ursolic acid in inhibiting biofilm formation. P values ? 0.05 were considered significant for univariate analysis.   Results Bacterial isolates and identification The isolated bacteria from dairy cows were identified by conventional methods. All of the 50 strains were found gram positive and catalase positive cocci. All the 50 strains were rabbit plasma-coagulase positive and are considered as S.aureus. Biofilm Detection Among the 93 S.aureus subjected biofilm detection 50 were found to be have positive for biofilm icaD gene by PCR. Of the 50 positive biofilm isolates 34 and 40 isolates were detected as biofilm agents by CRA and MTP methods. Study of Inhibitory Rates (%) For Biofilm Formation by Ursolic Acid Staphylococcal isolates treated with ursolic acid (30µg/ml) showed an inhibitory rate of 48.6% when compared to that of the isolates that were untreated, as tested by MTP assay (Fig 2). Further, the inhibitory percentage of biofilm formation of the Staphylococcal isolates when treated with ursolic acid at a concentration of 60µg/ml had increased to 71.5% (Fig 1). The inhibitory rate of biofilm formation between the ursolic acid treated groups i.e. 30µg/ml and 60 µg/ml for Staphylococcal isolates was 44.6%. Scanning Electron Microscopy (SEM) Electron microscopic studies showed that non biofilm Staphylococcus was in bunches with no extracellular matrix layer (slime layer) around the isolates (Fig 2a). For biofilm producing Staphylococcus, intracellular adhesions with a thick extracellular matrix layer was clearly seen (Fig 2b). For isolates grown in the presence of ursolic acid a decrease in the matrix layer was observed (Fig 2c). Molecular Characterization In their reactivity to oligonucleotide primers specific to icaD gene, mecA and pvl genes, 100% isolates were positive for icaD with specific PCR product of 381 bp (Fig 3a), 30% for mecA with a product size of 1050 bp (Fig 3b) and none of the isolates were tested positive for pvl. Comparative study of Staphylococcus sp. for methicillin resistance (mecA) and biofilm formation (icaD) genes by PCR showed that 80% of biofilm producers were methicillin resistant with mecA gene and 20% of non biofilm producers were methicillin sensitive. Discussion Staphylococcus aureus is a frequent cause of bovine mastitis and several techniques are used to characterize the bovine S.aureus strains. Rapid detection of methicillin resistance together with the identification of S.aureus is necessary for therapeutic and epidemiological purposes. Phenotypic based identification and susceptibility testing methods are time consuming and most have inherent limitations (Costa et al 2004). However, polymerase chain reaction based methods have shown to be a rapid and reliable approach for the identification and genotypic characterization of these organisms. mecA-based PCR methods are accepted as "gold standard" (Araj  et al 1997). Recently developed molecular methods provided a direct evidence of the genetic basis of slime production complementary to the CRA test. Slime synthesis is controlled by the ica (intercellular adhesion) operon (Arciola et al 2002). Biofilm formation by S. aureus contributes to a major extent in the disappointing cure rates of bovine mastitis. Adding to it, reports of alarming increase in cases of MRSA warrants immediate attention. In the present study we have attempted to understand the existing prevalence of isolated the Staphylococcus aureus in the milk of dairy cows on the date of drying. Biofilm formation capability of these isolates and prevalence of MRSA among these was tested. Furthermore, affect of Ursolic acid in dispersal of slime was also studied. For biofilm formation, molecular detection of ica D by PCR was found to be more sensitive to conventional methods such as MTP and CRA. Detection of icaD gene in Staphylococci isolates was in accordance with findings of Samah and Hanaa.(2013) who detected icaD gene in 62.5% of coagulase positive S.aureus and 47.1% in CNS. Considering the nature of biofilms in preventing the action of the antibiotics, we further tested the ability of Ursolic acid as an antibiofilm agent to disperse the slime layer around the organism. Ursolic acid at a concentration of 60ug/ml was found to significantly disperse the slime around the microorgaisms. Further, to look into if there exists any relation between the biofilm production, methicillin resistance and leukocidin toxicity we have subjected all the 50 positive icaD gene isolates for detection of mecA and pvl gene. Interestingly, 15 isolates out of the 50 positive icaD gene isolates have shown the presence of mecA gene and none of the isolates were positive for pvl gene. Absence of pvl gene in all isolates of Staphylococci indicated the absence of leukocidin toxin in the isolates tested which could be due to the fact that the isolates in the current study were from subclinial cases and not from the clinical cases. Prevalence of MRSA in the S. aureus isolates of the current study emphasizes the importance of failure in treatment strategies of bovine mastitis. Treatment strategies aimed towards a prophylactic approach of combining antimicrobials with biofilm dispersal agents can aid in combating the biofilms thereby making the organisms susceptible to antimicrobials in an efficient way. Conclusion In conclusion, findings of the present study demonstrated the great ability of the Staphylococcus aureus isolates to form biofilm even in the subclinical cases. Comparison of diagnostic techniques for detection of biofilm producing Staphylococcus showed that though  MTP  assay  had  the  advantage  of (over  traditional  PCR)  quantification  and  ease  of  performing  the  test,  PCR  was   quicker, and  had  highest  sensitivity  among  the  three  assays  tested. The presence of icaD in S.aureus in the microenvironment of the udder may lead to the inefficacy of antibiotic treatment against biofilm bacteria. The ability of the ursolic acid as a potential antagonist in preventing the biofilm formation could be useful as adjunct therapies for the treatment of MRSA biofilm-involved infections. Understanding  the  biofilm forming  capabilities of mastitic pathogens shall  further  help  in  designing  better  treatment  strategies.